pcas guide puro crispri scramble vector (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
94
Structured Review
OriGene
pcas guide puro crispri scramble vector
Pcas Guide Puro Crispri Scramble Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas+guide+vector/pCas-Guide-Puro-CRISPRi-Scramble/pmc13219498-365-1-3
Average 94 stars, based on 3 article reviews
Pcas Guide Puro Crispri Scramble Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas+guide+vector/pCas-Guide-Puro-CRISPRi-Scramble/pmc13219498-365-1-3
Average 94 stars, based on 3 article reviews
pcas guide puro crispri scramble vector - by Bioz Stars,
2026-11
94/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Reducing CXCR4 expression and/or function to enhance engraftment of hematopoietic stem cells Article Snippet: .. In one example for plasmid delivery to an HSC, the Article Title: Knock out aryl hydrocarbon receptor gene in adipose-derived mesenchymal stem cell line (PT-5006) by CRISPR/Cas9 Article Snippet: .. Generation of AD-MSC AhR-KO cell clones The AhR gene was knocked out in AD-MSCs using the pCas-Guide CRISPR vector carrying aryl hydrocarbon receptor gRNA (target sequence: CCTACGCCAGTCGCAAGCGG in exon 1 of the AhR gene, NCBI Reference Sequence: NM_001621), a donor vector containing the left and right homologous arms and GFP-Puro functional cassette, and a scramble sequence in the Article Title: The ER Thioredoxin-Related Transmembrane Protein TMX2 Controls Redox-Mediated Tethering of ER-Mitochondria Contacts (ERMCS) Article Snippet: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). .. The Article Title: Transcriptomic Investigation in CRISPR/Cas9-Mediated GRIK1-, GRIK2-, and GRIK4-Gene-Knockout Human Neuroblastoma Cells Article Snippet: .. In brief, the Article Title: Transcriptomic and Proteomic Analysis of CRISPR/Cas9-Mediated ARC -Knockout HEK293 Cells Article Snippet: .. A Article Title: Horizontal acquisition of a DNA ligase improves DNA damage tolerance in eukaryotes Article Snippet: .. This plasmid was co-transfected with the Article Title: Horizontal acquisition of a DNA ligase improves DNA damage tolerance in eukaryotes. Article Snippet: .. This plasmid was cotransfected with the Article Title: Multiple mechanisms activate GCN2 eIF2 kinase in response to diverse stress conditions Article Snippet: .. Deletion of ZAK in HEK293T cells was achieved by CRISPR using a Clone Assay:Article Title: Knock out aryl hydrocarbon receptor gene in adipose-derived mesenchymal stem cell line (PT-5006) by CRISPR/Cas9 Article Snippet: .. Generation of AD-MSC AhR-KO cell clones The AhR gene was knocked out in AD-MSCs using the pCas-Guide CRISPR vector carrying aryl hydrocarbon receptor gRNA (target sequence: CCTACGCCAGTCGCAAGCGG in exon 1 of the AhR gene, NCBI Reference Sequence: NM_001621), a donor vector containing the left and right homologous arms and GFP-Puro functional cassette, and a scramble sequence in the CRISPR:Article Title: Knock out aryl hydrocarbon receptor gene in adipose-derived mesenchymal stem cell line (PT-5006) by CRISPR/Cas9 Article Snippet: .. Generation of AD-MSC AhR-KO cell clones The AhR gene was knocked out in AD-MSCs using the pCas-Guide CRISPR vector carrying aryl hydrocarbon receptor gRNA (target sequence: CCTACGCCAGTCGCAAGCGG in exon 1 of the AhR gene, NCBI Reference Sequence: NM_001621), a donor vector containing the left and right homologous arms and GFP-Puro functional cassette, and a scramble sequence in the Article Title: Multiple mechanisms activate GCN2 eIF2 kinase in response to diverse stress conditions Article Snippet: .. Deletion of ZAK in HEK293T cells was achieved by CRISPR using a Sequencing:Article Title: Knock out aryl hydrocarbon receptor gene in adipose-derived mesenchymal stem cell line (PT-5006) by CRISPR/Cas9 Article Snippet: .. Generation of AD-MSC AhR-KO cell clones The AhR gene was knocked out in AD-MSCs using the pCas-Guide CRISPR vector carrying aryl hydrocarbon receptor gRNA (target sequence: CCTACGCCAGTCGCAAGCGG in exon 1 of the AhR gene, NCBI Reference Sequence: NM_001621), a donor vector containing the left and right homologous arms and GFP-Puro functional cassette, and a scramble sequence in the Article Title: The ER Thioredoxin-Related Transmembrane Protein TMX2 Controls Redox-Mediated Tethering of ER-Mitochondria Contacts (ERMCS) Article Snippet: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). .. The Article Title: Transcriptomic Investigation in CRISPR/Cas9-Mediated GRIK1-, GRIK2-, and GRIK4-Gene-Knockout Human Neuroblastoma Cells Article Snippet: .. In brief, the Article Title: Transcriptomic and Proteomic Analysis of CRISPR/Cas9-Mediated ARC -Knockout HEK293 Cells Article Snippet: .. A Functional Assay:Article Title: Knock out aryl hydrocarbon receptor gene in adipose-derived mesenchymal stem cell line (PT-5006) by CRISPR/Cas9 Article Snippet: .. Generation of AD-MSC AhR-KO cell clones The AhR gene was knocked out in AD-MSCs using the pCas-Guide CRISPR vector carrying aryl hydrocarbon receptor gRNA (target sequence: CCTACGCCAGTCGCAAGCGG in exon 1 of the AhR gene, NCBI Reference Sequence: NM_001621), a donor vector containing the left and right homologous arms and GFP-Puro functional cassette, and a scramble sequence in the Control:Article Title: The ER Thioredoxin-Related Transmembrane Protein TMX2 Controls Redox-Mediated Tethering of ER-Mitochondria Contacts (ERMCS) Article Snippet: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). .. The Generated:Article Title: Transcriptomic Investigation in CRISPR/Cas9-Mediated GRIK1-, GRIK2-, and GRIK4-Gene-Knockout Human Neuroblastoma Cells Article Snippet: .. In brief, the Article Title: Transcriptomic and Proteomic Analysis of CRISPR/Cas9-Mediated ARC -Knockout HEK293 Cells Article Snippet: .. A |